anti rabbit secondary antibody (Jackson Immuno)
Jackson Immuno is a verified supplier 
93
Structured Review
Jackson Immuno
anti rabbit secondary antibody
Anti Rabbit Secondary Antibody, supplied by Jackson Immuno, used in various techniques. Bioz Stars score: 93/100, based on 38 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sheep+anti+rabbit+igg/Peroxidase+AffiniPure+Rabbit+Anti-Sheep+IgG/bio_rxiv__64898__2026__03__24__713994-202-32-36
Average 93 stars, based on 38 article reviews
Anti Rabbit Secondary Antibody, supplied by Jackson Immuno, used in various techniques. Bioz Stars score: 93/100, based on 38 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sheep+anti+rabbit+igg/Peroxidase+AffiniPure+Rabbit+Anti-Sheep+IgG/bio_rxiv__64898__2026__03__24__713994-202-32-36
Average 93 stars, based on 38 article reviews
anti rabbit secondary antibody - by Bioz Stars,
2026-09
93/100 stars
Images
Related Articles
Blocking Assay:Article Title: Adenovirus-mediated RNA interference against collagen-specific molecular chaperone 47-KDa heat shock protein suppresses scar formation on mouse wounds. Article Snippet: It has been shown in many investigations that the abnormally increasing production and deposition of collagen is one of the important mechanisms of pathological scars and other fibrotic diseases [Wang Z, Inokuchi T, Nemoto TK, Uehara M, Baba TT.. Antisense oligonucleotide against collagen-specific molecular chaperone 47-kDa heat shock protein suppresses scar formation in rat wounds.. Plast Reconstr Surg 2003 May; 111(6):1980e7; Obayashi K, Akamatsu H, Okano Y, Matsunage K, Masaki H. Exogenous nitric oxide enhances the synthesis of type I collagen and heat shock protein 47 by normal human dermal fibroblasts. Western Blot:Article Title: Adenovirus-mediated RNA interference against collagen-specific molecular chaperone 47-KDa heat shock protein suppresses scar formation on mouse wounds. Article Snippet: It has been shown in many investigations that the abnormally increasing production and deposition of collagen is one of the important mechanisms of pathological scars and other fibrotic diseases [Wang Z, Inokuchi T, Nemoto TK, Uehara M, Baba TT.. Antisense oligonucleotide against collagen-specific molecular chaperone 47-kDa heat shock protein suppresses scar formation in rat wounds.. Plast Reconstr Surg 2003 May; 111(6):1980e7; Obayashi K, Akamatsu H, Okano Y, Matsunage K, Masaki H. Exogenous nitric oxide enhances the synthesis of type I collagen and heat shock protein 47 by normal human dermal fibroblasts. Immunostaining:Article Title: Photostable, amino reactive and water-soluble fluorescent labels based on sulfonated rhodamine with a rigidized xanthene fragment. Article Snippet: The invention of lens-based (far-field) optical nanoscopy spurred a search for novel fluorescent tags which facilitate an optical resolution in the nanometre region.. For example, the first viable approach to break the diffraction barrier, stimulated emission depletion (STED) fluorescence microscopy requires fluorophores that are particularly photostable.. Laser dyes are characterized by high resistance towards photobleaching, implying that they may well serve as lead structures for developing novel highly photostable markers. Incubation:Article Title: TIGIT impairs NK cell antifibrotic activity through the IFNγ-IFI30 axis in schistosomiasis-induced liver fibrosis. Article Snippet: Gene name Forward primer sequence (5'→3') Reverse primer sequences (5'→3') GAPDH c AAGGTGAAGGTCGGAGTCAAC GGGGTCATTGATGGCAACAATA Gapdh (Mouse) TGTTCCTACCCCCAATGTGTC TGAAGTCGCAGGAGACAACC TIGIT (Human) TGGTGGTCATCTGCACAGCAGT TTTCTCCTGAGGTCACCTTCCAC Tigit (Mouse) GCTGTGCTGGGACTCATTTG GAGAGACTCCTCAGGTTCCATTC GZMB (Human) GTGGCTTCCTGATACGAGACG AACTGCTGGGTCGGCTCC Gzmb (Mouse) TCCCCGTCTCTTCGTAAGC AGGAGCTGTCAGACCCCTTC IFNG (Human) TGTGGAGACCATCAAGGAAGAC ATGTATTGCTTTGCGTTGGAC Ifng (Mouse) CAGCAACAGCAAGGCGAAAAAGG TTTCCGCTTCCTGAGGCTGGAT Acta2 CCCTGAAGAGCATCCGACA CTCCAGAGTCCAGCACAATACC Col1a1 GAGGGCGAGTGCTGTGCT GTCCAGGGATGCCATCTCG IFI30 (Human) TGTCACGCTGGTGCCCTAC CCTTGTTGAATTTGCACTCCTC Ifi30 (Mouse) ATCCTCCGAAGGCACAACC GGACGAGGAAGTAGCGACAAG SPRED3 (Human) GTTTACAACAAGGTGAATCCCATC TCTGAAACGTCAGTCCAAACTTG TREX2 (Human) GAGCTGTCCCTCTTTGCTGTCC GGCAATACTAGGGCACCAGACTC GNPDA1 (Human) TGACATCCACCCAGAAAACACC ACAAATAGCTCGATCCCACCTG IRAK2 (Human) ACTTCAGCACCTCCATTCCTAAG TGGCTGATTTTGCGGTTTTG TENM1 (Human) TTGATCATATAACCCGCACAGG ATCCCGAAGGTGAATATGTGATG SNX13 (Human) AGACTGGCAACCTTATTTTACTACAC CTGTTATTTTCTGTTGAGCCTTTC DAAM1 (Human) GGACCTCACAGACAAACACAGAG TTTCTTGCTACAGTATATTTGCCA SERPINE1 (Human) CTCATCAGCCACTGGAAAGGCA GACTCGTGAAGTCAGCCTGAAAC TNFSF13B (Human) AATCTTTGAACCACCAGCTCCA GTTTCTTCTGGACCCTGAACGG frontiersin.org 1-AP; ProteinTech). .. After washing, membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies, Article Title: Regulation of mTOR Pathway in Exercise-induced Cardiac Hypertrophy. Article Snippet: Introduction ▼ Different intensities of long-term exercises are involved in a host of sports, positive lifestyle and even vital strategies for treating cardiovascular diseases.. It is generally believed that these exercises will cause adaptive changes to myocardium in terms of both morphology and function, inducing so-called exercise-induced cardiac hypertrophy [57].. Studies show that double cardiac effects could be achieved by high-intensity exercise (85– 90 % VO2max) compared to moderate exercise intensity (65–70 % VO2max) [20]. Article Title: Androgen interacts with exercise through the mTOR pathway to induce skeletal muscle hypertrophy Article Snippet: The membranes were probed with primary antibodies as follows: myosin heavy chain (MHC), AR, and phospho Ser210 -AR from Abcam (Cambridge, UK); phospho Ser2448 -mTOR, phospho Thr389 -p70 ribosomal S6 kinase (p70 S6K ), and phospho Thr37/46 -eukaryotic translation initiation factor 4E-binding protein 1 (4EBP1) from Cell Signal Technology (Massachusetts, USA). β-actin antibody from Santa Cruz Biotechnology (Dallas, USA) was used as the loading control. .. After washing, membranes were incubated with horseradish-conjugated sheep anti-mouse IgG and Article Title: Selective Neurodegeneration, Without Neurofibrillary Tangles, in a Mouse Model of Niemann-Pick C Disease Article Snippet: .. Briefly, the thin frozen sections were treated as follows: 1) incubation in 10% normal sheep serum in phosphate-buffered saline (PBS)-T solution (PBS with 0.3% Triton X-100, pH 7.0) for 30 minutes; 2) incubation in rabbit polyclonal antibody against the cholinergic enzyme choline acetyltransferase (ChAT; 1:500; Chemicon, Temecula, CA) in PBS-TSS (PBS-T with 1% normal sheep serum) for 18–24 hours at room temperature (with agitation on a shaker table for all incubation and rinse steps); 3) incubation in 1:100 Article Title: TIGIT impairs NK cell antifibrotic activity through the IFNγ–IFI30 axis in schistosomiasis-induced liver fibrosis Article Snippet: Membranes were blocked and then incubated overnight at 4 °C with the following primary antibodies: Mouse Anti-GAPDH (Cat. No. 5174; CST, Danvers, MA, USA), Rabbit Anti-Bcl-2 (Cat. No. 4223; CST), Rabbit Anti-Bax (Cat. No. 50599-2-Ig; ProteinTech, Wuhan, China), Rabbit Anti-Collagen I (Cat. No. 72026; CST), Rabbit Anti-α-Smooth Muscle Actin (α-SMA; Cat. No. 19245; CST), Rabbit Anti-TIGIT (Cat. No. 99568; CST), and Rabbit Anti-IFI30 (Cat. No. 15112-1-AP; ProteinTech). .. After washing, membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies, Saline:Article Title: Selective Neurodegeneration, Without Neurofibrillary Tangles, in a Mouse Model of Niemann-Pick C Disease Article Snippet: .. Briefly, the thin frozen sections were treated as follows: 1) incubation in 10% normal sheep serum in phosphate-buffered saline (PBS)-T solution (PBS with 0.3% Triton X-100, pH 7.0) for 30 minutes; 2) incubation in rabbit polyclonal antibody against the cholinergic enzyme choline acetyltransferase (ChAT; 1:500; Chemicon, Temecula, CA) in PBS-TSS (PBS-T with 1% normal sheep serum) for 18–24 hours at room temperature (with agitation on a shaker table for all incubation and rinse steps); 3) incubation in 1:100 |
